Simulation Tools¶

Several tools can automate molecular cloning workflows. ApE and Benchling offer graphical interfaces for simulating steps like PCR, Golden Gate, Gibson, and digestion reactions. Alternatively, C6-Tools provides a scripting-based approach using Construction File (CF) shorthand, and is available both as a web tool and as a Google Sheets plugin:

🔗 Open C6-Tools in Google Sheets

The Google Sheets version includes a library of DNA design functions that you can access directly from spreadsheet cells. These include methods for PCR, Digest, Ligate, GoldenGate, and Gibson, as well as functions for parsing and simulating CF scripts. Visit the linked page and follow the instructions to get started.

Understanding CF Syntax¶

The Construction File (CF) format is a streamlined way to describe molecular cloning procedures using a structured table-like syntax. Each line specifies either:

An operation to perform (e.g., PCR)
A sequence element involved in the operation (e.g., an oligo or plasmid)

Each line begins with a keyword (like PCR, oligo, or plasmid) followed by a set of fields separated by either tabs or multiple spaces. These fields define the names and sequences needed for simulation.

PCR Line Breakdown¶

For example, the line:

PCR          exFor2      exRev2      pTemp1       pcrpdt2

...defines a PCR reaction using:

a forward primer called exFor2
a reverse primer called exRev2
a circular DNA template called pTemp1
a product that will be named pcrpdt2

Naming Rules¶

Each name (or "identifier") you use for DNA sequences—like primers, templates, or products—needs to follow specific rules:

You can use: letters, numbers, dashes (-), underscores (_), dots (.), plus signs (+), and backticks (`)
Do not use: commas, spaces, quotes, parentheses, or other special symbols—they can cause errors during simulation
Names are case-sensitive: pTemp1 and ptemp1 would be treated as different sequences

You will learn other operation types like Digest and GoldenGate later in the tutorial, and this tool below can simulate those too. For now, focus on reading and writing PCR-related lines.

Try it out¶

Now it’s your turn to explore how CF syntax works in practice. The example below defines a PCR reaction using two primers and a circular DNA template. Try copying and pasting it into the form to simulate the result. Then, try breaking things on purpose—like deleting the last 10 bases of a primer or giving two sequences the same name—to see how the tool catches design errors and helps you debug. This is a quick way to test your understanding before moving on to more complex operations.

PCR          exFor2      exRev2      pTemp1       pcrpdt2

oligo        exFor2      ccataGAATTCCAGCGGATCGGATCGGCGAC
oligo        exRev2      cagatGGATCCCGGTTGTGCGGGCGGAACC
plasmid      pTemp1      CTGGTGACCCAGCGGATCGGATCGGCGACCCAAAGCGCCTGGTTCCGCCCGCACAACCGCGA

The C6 simulation algorithm inputs both the construction file and an (optional) list of sequences with their names. The algorithm will include both the sequences embedded in the CF as well as those in the separate list. In these tutorials, we have injected the plasmids named in the various examples into this list. For other sequences, you will need to put them in the CF.

DNA Autoannotation and Simulation¶

The tutorials can also autoannotate your sequence, detect transcriptional units, and predict which proteins are potentially expressed or will not be expressed. This can be helpful for detecting design errors. This capability is only displayed on this page.